Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_Ex_c4921_8764088

[ Printable Version ]  [ Submit comment/correction ]

Sequence
wsnp_Ex_c4921_8764088
Contig
5AL_2759224
Probe
wsnp_Ex_c4921_8764088
DNA Homology
5AL_2759224Best IWGSC match3640URGI_BestIWGSC_N
BLAST, e-value
05AL_2759224Best IWGSC match
DNA
gcatgtcggtgtcgttctcaggcgcctcatcgtcctcgtcaatgctcagg
ccaagcttgagcatgcggtggatcctggtgccraaggtgttggggtcctc
Maggctgaagccggaggtgagcagggaggtctcgaagagcagcatcacca
ggtccttgactgacttgtcgttcttgtcggcgtcggcgcgcttgcggagc
t
BLAST
BLAST Search