Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_Ex_c5072_9006666

[Submit comment/correction]

Sequence
wsnp_Ex_c5072_9006666
Contig
4AL_7105505
Probe
wsnp_Ex_c5072_9006666
DNA Homology
4AL_7105505Best IWGSC match3630URGI_BestIWGSC_N
BLAST, e-value
04AL_7105505Best IWGSC match
DNA
tagatgtggcaggaactgaacagattcgtgtgaagctggagaaggcaatg
agagattcacgaggaattctttcagaagtgaagcaagcacagattgtcca
Rcaatgcaagacggcgaatcttgtctggatcggtcaaggcaagttaggcc
ctctgcagccacaccagatggaagcgatactaggctatccagctaaccac
a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.