Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_Ex_c53843_56941644

[ Printable Version ]  [ Submit comment/correction ]

Sequence
wsnp_Ex_c53843_56941644
Contig
4AS_5939008
Species
Triticum aestivum
Probe
wsnp_Ex_c53843_56941644
DNA
GCTCACTTCATCAATGGCTGAAAGAGCACTCACTGGGTCTAATATCTTCG
CTATCGCATCTGTTAGTGAAGTGGCATAATCTGTGTGGTTGCAAAGGTTC
RGCTTGTAATGTGTATATGGGTCAAGGACAGCAGCTGCAACCATAAATGT
ATCTTCTTCCATTGCATCTATCCTCTTGCCCACCTTGCGCATGAACGAAA
G
BLAST
BLAST Search