Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_Ex_c5740_10081171

[Submit comment/correction]

Sequence
wsnp_Ex_c5740_10081171
Contig
2AL_6422590
Probe
wsnp_Ex_c5740_10081171
DNA Homology
2AL_6422590Best IWGSC match2460URGI_BestIWGSC_N
BLAST, e-value
02AL_6422590Best IWGSC match
DNA
aaaagaagttggagaaggctgtcttgccaaatcgcaccttcttccatctg
ctcttgaacaggtacggatggagacccaatacgtgctcaggcatgaagtc
Rtgccgtgttaatatgccaacaacaggcgccctcttggaagtttttggaa
gaaccaaaaggtgtcttaatccaacttcacgaaaaagtataagagcttta
g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.