Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_Ex_c5769_10136243

[ Printable Version ]  [ Submit comment/correction ]

Sequence
wsnp_Ex_c5769_10136243
Contig
4DL_14424851
Probe
wsnp_Ex_c5769_10136243
DNA Homology
4DL_14424851Best IWGSC match1483e-33URGI_BestIWGSC_N
BLAST, e-value
3e-334DL_14424851Best IWGSC match
DNA
actcccggattttggattgagatatctttatttgttccttttcattgtca
tcctgaagaatctgatcttcatccaaatgctcaaccacacattcttcaag
Rttttccatgtgactttcctcacgacttgttgtgtcacgcaccttttgct
ctgtttcaacatggaacggcttatcagaagatagaggtttaacatcttcc
t
BLAST
BLAST Search