Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_Ex_c58286_59646499

[Submit comment/correction]

Sequence
wsnp_Ex_c58286_59646499
Contig
4AL_7144713
Probe
wsnp_Ex_c58286_59646499
DNA Homology
4AL_7144713Best IWGSC match3680URGI_BestIWGSC_N
BLAST, e-value
04AL_7144713Best IWGSC match
DNA
cagcagagacttcaaaacagaaagtatttgattgtactggatgatgtctg
ggagcaagatgtgtactttcagatacatgatgctctccaggatctcccgg
Raagtcggatcatcattacgacacggaaggaccatgtcgccggaatttct
tctcccaaccgtcatcttgagctcgagccattgagcaagtctgatgcatt
t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.