Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_Ex_c6209_10838456

[Submit comment/correction]

Sequence
wsnp_Ex_c6209_10838456
Contig
5AS_1517305
Probe
wsnp_Ex_c6209_10838456
DNA Homology
5AS_1517305Best IWGSC match3680URGI_BestIWGSC_N
BLAST, e-value
05AS_1517305Best IWGSC match
DNA
ggtacgtgtactgcacgatactcgacagcatagcgaaggtgactggcgtc
atcaaattcgacctgcacgccgagccagagagcggcaagaagcagcttga
Rgttggggggaatgtgatgggcatatatgacctgggacctggtaggttcg
gctcggaggcggtctttgtgcccaaggagcccggtgtgtctggggaagaa
g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.