Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_Ex_c62404_62055681

[Submit comment/correction]

Sequence
wsnp_Ex_c62404_62055681
Probe
wsnp_Ex_c62404_62055681
DNA
GMTCTACATCATTCTCTGCATCATGAAACCCATTATCTTTGGCATCCACA
GTTTCATCATCTGTAGACTCTTCACTTCCACTATCTTGAATTCGAGAATC
Rggtgagagggaacaccttgggtgttcatcatcaaatatgctctcatatt
cctctaatagagttgtgacaatgcattgagcattgttagcagcatttgca
g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.