Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_Ex_c649_1279852

[Submit comment/correction]

Sequence
wsnp_Ex_c649_1279852
Contig
1BL_3797612
Species
Triticum aestivum
Probe
wsnp_Ex_c649_1279852
DNA
ATCCCTGTCCTTGCCGGTGGGAGGGCTCCTGCTTCATTTTTAAGTGTGTT
TTTAGTCTGTTTAGGGTTTGTGTCCTGCTCAAATCGACGAGACAGTGGTG
RCTTTCTGAAGTTGGAATAAGGTTCTCCCCGCATAGCCCCCGTTCTTACG
GTGCAACTAGTGCCATGGGAGGGCGGGTCGATATTTATCTCCTGCGGATC
T

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.