Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_Ex_c7168_12311649

[Submit comment/correction]

Sequence
wsnp_Ex_c7168_12311649
Contig
5AL_2805103
Probe
wsnp_Ex_c7168_12311649
DNA Homology
5AL_2805103Best IWGSC match3240URGI_BestIWGSC_N
BLAST, e-value
05AL_2805103Best IWGSC match
DNA
gcgggttcggcgccgaatttcgatggtcagttacaagcagcagatcatcc
agagattgagttctagacgatcacaggatcactgataatcaccaaggccc
Rtatttttgtacataagaaaagtatggcgagtgaagctcctaagctaacg
gtcttttgacttccggactgagaactgatttgatcatccacatccgatgc
c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.