Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_Ex_c7291_12517871

[Submit comment/correction]

Sequence
wsnp_Ex_c7291_12517871
Contig
3B_10753175
Probe
wsnp_Ex_c7291_12517871
DNA Homology
3B_10753175Best IWGSC match2650URGI_BestIWGSC_N
BLAST, e-value
03B_10753175Best IWGSC match
DNA
ctgagttttctgtccgagcagttcctggatttctcaagcaatttggacac
actgccagcccgattgatgcccttgcagaagcatttgtaagtagtgacac
Rgcatttagagaagagttaattgctcaccagaagtcaaaaaggataatcc
agaaagactggcatcctggttgcacggcagtgacagcattgatagtgaga
a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.