Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_Ex_c7447_12751589

[Submit comment/correction]

Sequence
wsnp_Ex_c7447_12751589
Contig
1BL_3908302
Probe
wsnp_Ex_c7447_12751589
DNA Homology
1BL_3908302Best IWGSC match3680URGI_BestIWGSC_N
BLAST, e-value
01BL_3908302Best IWGSC match
DNA
agcccttttgaccttgcttctgatcctgacgaggcagccattcctggctc
ggctccgtcaatcatgcatcggcgaaataacctgtttgaacccccttctg
Racaatcagatgatagcagtgtatctgcacatgataacttggactctcaa
gaaatcataacaggctcccgccgagacatgatcttcaagagacatgatac
c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.