Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_Ex_c8019_13598142

[Submit comment/correction]

Sequence
wsnp_Ex_c8019_13598142
Contig
5BL_10900559
Probe
wsnp_Ex_c8019_13598142
DNA Homology
5BL_10900559Best IWGSC match3570URGI_BestIWGSC_N
BLAST, e-value
05BL_10900559Best IWGSC match
DNA
ctaaaaacattaaggtgccaggggatcccccaacactcagaataaaccag
cctaggaatctactccccggggcgtaggagctcccatgagtttggggcaa
Rggttatgtacattacaacagaaaatggaagcatcatcgcattaaacggc
tgcggcgctcgtcacgtacgacaccacgaccgtgatgtcgtcaagcttcc
c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.