Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_Ex_c831_1625061

[Submit comment/correction]

Sequence
wsnp_Ex_c831_1625061
Contig
5BS_2272737
Probe
wsnp_Ex_c831_1625061
DNA Homology
5BS_2272737Best IWGSC match3290URGI_BestIWGSC_N
BLAST, e-value
05BS_2272737Best IWGSC match
DNA
gccgcaagcgataatcctccttcgataccaaccgctacatctcctttggc
aacaacagctacctctaaagatgatgcctacgcctccgctcccgcaccag
Maaatcaagtctgacgttagcttgtaactatggaacggttgtctttgcct
tccaaaaggaggaacatgctttctggaccgttgtaagtggaaggcagtcg
t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.