Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_Ex_c8543_14357051

[ Printable Version ]  [ Submit comment/correction ]

Sequence
wsnp_Ex_c8543_14357051
Contig
5AL_2805613
Probe
wsnp_Ex_c8543_14357051
DNA Homology
5AL_2805613Best IWGSC match2850URGI_BestIWGSC_N
BLAST, e-value
05AL_2805613Best IWGSC match
DNA
tctccggtaaagctagcagtgctttgttctgttgattacattggcctctg
gcaagccgagaacagctgccagctgatgaaagccataaccagcgaggaga
Mgagctcgaagccgaccaccttgggagtctgccactccaatgatctccgt
aagtaactggtgatagatggcattgttgccagaagcagagcacatgcata
a
BLAST
BLAST Search