Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_Ex_c8913_14881924

[Submit comment/correction]

Sequence
wsnp_Ex_c8913_14881924
Contig
4BS_4925666
Probe
wsnp_Ex_c8913_14881924
DNA Homology
4BS_4925666Best IWGSC match3610URGI_BestIWGSC_N
BLAST, e-value
04BS_4925666Best IWGSC match
DNA
ctcctaccgccccagtgatctcagccgagaaggcttaccatgagcagctc
tctgttgccgagatcaccaacagcgccttcgagccttcctccatgatggc
Maagtgtgacccccgccacggcaagtacatggcctgctgcctcatgtacc
gtggtgatgttgtgcccaaggatgtcaacgccgctgtggccaccatcaag
a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.