Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_Ex_c97184_84339976

[ Printable Version ]  [ Submit comment/correction ]

Sequence
wsnp_Ex_c97184_84339976
Contig
5BL_10849469
Probe
wsnp_Ex_c97184_84339976
DNA Homology
5BL_10849469Best IWGSC match3630URGI_BestIWGSC_N
BLAST, e-value
05BL_10849469Best IWGSC match
DNA
ttccagcttctgtgcttcagggagctcaagacaaatgttagaatatttac
ccaatggatgatgtaatctctaggtatcttttgtgcgctagctgtgccaa
Rcagccgttatgtatgttcatctaattgtcacttctcatttctcctgtta
acactggtcttacttatgctagtataatttaggaaacctgcatagtaaca
t
BLAST
BLAST Search