Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_Ex_c974_1864971

[Submit comment/correction]

Sequence
wsnp_Ex_c974_1864971
Contig
5DL_4604954
Probe
wsnp_Ex_c974_1864971
DNA Homology
5DL_4604954Best IWGSC match3030URGI_BestIWGSC_N
BLAST, e-value
05DL_4604954Best IWGSC match
DNA
gagatttgacctatgaaaccttcgaagtaaaaagtggtgagatttggagc
attgctctctaccacctgcagcctatcacaatcagccacctccagaaaac
Rgagacgctgcagcagagaaggtatcttcaaggaaattatctccttgcag
tactggagtatcaagcacaccaaagcgggagaattrgaaaggagacacca
t
BLAST
BLAST Search

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.