Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_Ex_c9779_16145653

[Submit comment/correction]

Sequence
wsnp_Ex_c9779_16145653
Contig
6DS_1128939
Probe
wsnp_Ex_c9779_16145653
DNA Homology
6DS_1128939Best IWGSC match3420URGI_BestIWGSC_N
BLAST, e-value
06DS_1128939Best IWGSC match
DNA
caccatgccgaatcctgtggctgattcggcaatcagccgagttgactgtg
ataccgtggcgcagagagacggctcggtgctgtcttttgcgcctgcatct
Ragaatgtgctcgattttgatgcgcaccaccagctgaacctcagtgacac
agagtctgtggtgcagcagttccctgcgtgcccgctcaatcrgagcgagt
a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.