Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_Ex_c9805_16183499

[ Printable Version ]  [ Submit comment/correction ]

Sequence
wsnp_Ex_c9805_16183499
Contig
2BL_7942774
Probe
wsnp_Ex_c9805_16183499
DNA Homology
2BL_7942774Best IWGSC match3680URGI_BestIWGSC_N
BLAST, e-value
02BL_7942774Best IWGSC match
DNA
atgtatgttccaaataagcatagaacataaattatagaacaatgcaatca
taggtacacactcacaccagtagtatagtaatgactaataagcatgaaaa
Rtatacatgaatatatagtttgctgacaaattcttcagaagaacgacaat
ttgttccacaagtaacccaggaagtttatcagaactctctgtgatcgtat
t
BLAST
BLAST Search