Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_Ex_rep_c101615_86954680

[Submit comment/correction]

Sequence
wsnp_Ex_rep_c101615_86954680
Species
Triticum aestivum
Probe
wsnp_Ex_rep_c101615_86954680
DNA
aacgaaagatgaccaaggaagagagattagagatggtgaaagctggaagg
gaggatagaggaaaataccaagcaagagcagctattaaacagaaaaagac
RGGTGGCTCGAGCAATAAGCAGAAACAGCACCAGAAGAGGATGCCTCTGG
CGGCAAAGAGAGCAAAGGCAGCGCGTTCTCGGCAGGAGAAGAAGACCAAA
G

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.