Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_Ex_rep_c102070_87317290

[Submit comment/correction]

Sequence
wsnp_Ex_rep_c102070_87317290
Contig
5BL_10833598
Probe
wsnp_Ex_rep_c102070_87317290
DNA Homology
5BL_10833598Best IWGSC match3680URGI_BestIWGSC_N
BLAST, e-value
05BL_10833598Best IWGSC match
DNA
ttatatgataatataatatgtcatgctaatcgagaggcttggctactttt
ttcatggaaaaacaatgtacatactagtatgagaactaaacccatattgc
Raagtagctggtggtggttggtgtcccctatggttgagtgtagttgtgca
aataacgagtttgttgaataaaattctccatttttcgctctgataatttt
a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.