Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_Ex_rep_c104125_88923836

[Submit comment/correction]

Sequence
wsnp_Ex_rep_c104125_88923836
Contig
3AL_4322832
Probe
wsnp_Ex_rep_c104125_88923836
DNA Homology
3AL_4322832Best IWGSC match2610URGI_BestIWGSC_N
BLAST, e-value
03AL_4322832Best IWGSC match
DNA
agtggcctttcaaaagtaatggggaagcatggtacaaacttggacaatat
tagaaagatttctggagctgacattgaaattattgaatcaaaatcatctc
Rtcatgagcatgttgctcacatatttggcacccctgagcagaggcagtcg
gcagagaatttgatcaaagctttcataatgtctacttaaggacgtacttc
c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.