Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_Ex_rep_c66551_64836327

[Submit comment/correction]

Sequence
wsnp_Ex_rep_c66551_64836327
Contig
2BS_5179105
Probe
wsnp_Ex_rep_c66551_64836327
DNA Homology
2BS_5179105Best IWGSC match3680URGI_BestIWGSC_N
BLAST, e-value
02BS_5179105Best IWGSC match
DNA
tgttggacggcctgtacatgcaccaggaccttgacggatcaccaaatcag
aaccagaaaactatagtgaatcctaacctccctctgcagtttggctgcac
Mgtggctaatgactggaccatatatgatggccttggccccgataagaagc
ttgttgcgcgtgcacaagggccacatatgggggcaggagtagccaaagga
a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.