Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_Ex_rep_c66651_64962429

[ Printable Version ]  [ Submit comment/correction ]

Sequence
wsnp_Ex_rep_c66651_64962429
Contig
5BL_10824686
Probe
wsnp_Ex_rep_c66651_64962429
DNA Homology
5BL_10824686Best IWGSC match3220URGI_BestIWGSC_N
BLAST, e-value
05BL_10824686Best IWGSC match
DNA
cctcatcgagggacaccgctgcactgcccattacagggcattcctttttt
gcagttggagacagcatggttcctgaagaagaaccccttctgcagattac
Rgagtgccgtatttgtcaggaggaagatgacattaagaatctagagagcc
cctgtgcttgcaccggcagtgtaaagtatgcgcatagggcttgtgtacaa
a
BLAST
BLAST Search