Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_Ex_rep_c67635_66291944

[Submit comment/correction]

Sequence
wsnp_Ex_rep_c67635_66291944
Contig
3AS_3381649
Probe
wsnp_Ex_rep_c67635_66291944
DNA Homology
3AS_3381649Best IWGSC match3680URGI_BestIWGSC_N
BLAST, e-value
03AS_3381649Best IWGSC match
DNA
tggagcctgtggtggccccagctttctcaccagactcatcctttgtgcca
gcactaacagcttctgaaaatttttgtacagcatcctcaaggtttctcct
Rtcactggttgaactccttccatattttgacatgctgcctgatttttcac
tgtccaaggagatcttcaagttaagtgatatatcatgaatatccctcaaa
g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.