Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_Ex_rep_c67665_66326492

[ Printable Version ]  [ Submit comment/correction ]

Sequence
wsnp_Ex_rep_c67665_66326492
Contig
1BS_1134305
Species
Triticum aestivum
Probe
wsnp_Ex_rep_c67665_66326492
DNA Homology
1BS_1134305Best IWGSC match2130URGI_BestIWGSC_N
BLAST, e-value
01BS_1134305Best IWGSC match
DNA
ttatatccatcttatcaaattcatcaatacaacagatgccattatcagct
aacatgagtgcacctgcctcaatacaaaattcaccggtctcaggttcttt
YGCAACAGTTGCTGTCAATCCAGCAGCAGACGAGGACTTCCCTGATGTGT
AAACAGATCGCGGAACAATACCAGCAGTGTATTTTAAAAACTGAGACTTT
G
BLAST
BLAST Search