Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_Ex_rep_c69475_68416668

[Submit comment/correction]

Sequence
wsnp_Ex_rep_c69475_68416668
Contig
5AL_2774710
Probe
wsnp_Ex_rep_c69475_68416668
DNA Homology
5AL_2774710Best IWGSC match3610URGI_BestIWGSC_N
BLAST, e-value
05AL_2774710Best IWGSC match
DNA
tcgccttcgtctgaatctgagtgcctttgaggaaagacaactctaatatc
attgtagagataaaatcgcctctcttcctcgataacagtactccgattga
Rtggttctggtgacatgccaggttygrtccgctgcatcgatcttgatgat
ttcttggaaaaggggctcagaaaacgcaggtgcaaagcataacgaagaac
g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.