Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_Ex_rep_c70756_69644826

[Submit comment/correction]

Sequence
wsnp_Ex_rep_c70756_69644826
Contig
2BS_5178681
Probe
wsnp_Ex_rep_c70756_69644826
DNA Homology
2BS_5178681Best IWGSC match1930URGI_BestIWGSC_N
BLAST, e-value
02BS_5178681Best IWGSC match
DNA
aggaaggtgaagaaaatacagtggtctgcatttacaacwtagaagagtac
atttcgctggtagtggatgctacacttaaggctggaataatgcgccaagt
Rgaagcattcaaagctggatttaatcaggtatttgatatatcatcactcc
aaatattttctcctcaagagcttgactatctcatttgtggtcgacgggaa
c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.