Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_Ex_rep_c71023_69867676

[Submit comment/correction]

Sequence
wsnp_Ex_rep_c71023_69867676
Probe
wsnp_Ex_rep_c71023_69867676
DNA
GTTGTTCGCCCCTTAAATCAAGTTCTGTCAATTATGGCTGATCAAGATTT
GGTTCATCACATGGATAATGATGCTACTAGTGCCGATGACCTGCAAAAAA
YGTATACTGTTGAGGAATTTGAAGTTCGCGTATTAGAGTTGGAGAAACCT
AGTGGACGTTGGGAGACAAGGTCCACTATTCCAATGCAATCATTTGAAAA
T

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.