Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_Ex_rep_c71116_69944350

[ Printable Version ]  [ Submit comment/correction ]

Sequence
wsnp_Ex_rep_c71116_69944350
Contig
2BS_5214231
Probe
wsnp_Ex_rep_c71116_69944350
DNA Homology
2BS_5214231Best IWGSC match3680URGI_BestIWGSC_N
BLAST, e-value
02BS_5214231Best IWGSC match
DNA
caatgcttttgtaacgacaatctcttcagcaagattcttaattgtgtatc
ggttacaagtcagttcagccagaggcaagtaagctataagctatacctgg
Rggactgcagcaaatgcgcatgtgtctttttaggcgcggaaaaggcccct
gctgtatgtagcgctgcagacctacattcgttgtacagcgaacctaatat
g
BLAST
BLAST Search