Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_JD_c1872_2603061

[Submit comment/correction]

Sequence
wsnp_JD_c1872_2603061
Contig
2AL_6333995
Probe
wsnp_JD_c1872_2603061
DNA Homology
2AL_6333995Best IWGSC match3180URGI_BestIWGSC_N
BLAST, e-value
02AL_6333995Best IWGSC match
DNA
ttggttctaaggtctcagggacaaccgctgatgcaccagctttctccaaa
ttaacaccatgatcaacatcatgtgctctgacaaatgtcttcacatttgg
Raagtatttgctcagagcccatacagctctatagtttgcaccaggagtat
ctaaagtaatggcagcagcacatgccctctcagctccaactttgtgacag
t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.