Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_JD_c3839_4902725

[ Printable Version ]  [ Submit comment/correction ]

Sequence
wsnp_JD_c3839_4902725
Contig
6AL_5775268
Probe
wsnp_JD_c3839_4902725
DNA Homology
6AL_5775268Best IWGSC match2960URGI_BestIWGSC_N
BLAST, e-value
06AL_5775268Best IWGSC match
DNA
tgtctatacggaggataacagctttatacttttctgactctctaacagta
cgtatcttcttgattaactgctcggcaataatgcccgaactagaaatact
Maggccactgcgagttcgtgttatgcttccagatgctctgattactgcta
ttaagtctcctcctcctcctatcccaagagttgattttcttacacgtgaa
t
BLAST
BLAST Search