Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_JD_c5170_6293946

[Submit comment/correction]

Sequence
wsnp_JD_c5170_6293946
Contig
3DS_2552270
Species
Triticum aestivum
Probe
wsnp_JD_c5170_6293946
DNA
ggcgcagagcttggtttcctgtacagcgtgcctgagcagagcttcctggt
tctctttgaccgccttacacttcccgagtgaatgagatctctttccgaaa
YGAGCTGATTCTCACATGGGAGGGAATCCCATGGAGAGACAAACTGGCCT
GATTTCAGGTGGCCAAAAGTAGGTTCCGCATGGCTTTCTCCATCATCCTC
A

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.