Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_JD_c5499_6647799

[Submit comment/correction]

Sequence
wsnp_JD_c5499_6647799
Contig
4AS_5928658
Species
Triticum aestivum
Probe
wsnp_JD_c5499_6647799
DNA
ATYCAATTAACTCATAATCATATTCTTCATAATTTTCATCATCTGATAGT
TCTTCCACTAACTGTTGAGCAACAATCATTGATTTCAGTTCATCCTGTTG
RAAGGAGCCATTGTTATGGACACTTGCTAACTCATCATTTYGTAGATTAG
AATCAGTTAGCACAGACTTTGATTGCTCCGTAAGTTCACCATCTGATGAA
G

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.