Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_JD_c6664_7807201

[Submit comment/correction]

Sequence
wsnp_JD_c6664_7807201
Contig
1AL_3878629
Probe
wsnp_JD_c6664_7807201
DNA Homology
1AL_3878629Best IWGSC match3550URGI_BestIWGSC_N
BLAST, e-value
01AL_3878629Best IWGSC match
DNA
aagcacgggacaaactgcctactaacgtttaagtcagccagtacattgtt
acaatgctactacagatatggctgacggtggcagtaaatgacatcaacac
Rttgagatcatagagtattatagttacacttgctcatgcaccatcgtcat
cttcaacagtgttgacacgctcgcactcatcgatccattcgctgtataca
t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.