Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_JD_c9902_10674725

[Submit comment/correction]

Sequence
wsnp_JD_c9902_10674725
Contig
3B_10504374
Probe
wsnp_JD_c9902_10674725
DNA Homology
3B_10504374Best IWGSC match2850URGI_BestIWGSC_N
BLAST, e-value
03B_10504374Best IWGSC match
DNA
tgtacaccctatctgaaagattctcacaattttacaccaactgccaggtt
gtcgggtcaccggaggaaacgagccgcctgttgctgtgccaagcgtcggc
Rgtcgtcatgcggcaatgcttccacctgctgggcataacaccagtgcaca
agctatagaagtcgatggatgctctagttagtaaattatcattgaactcr
t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.