Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_JD_rep_c48914_33168544

[Submit comment/correction]

Sequence
wsnp_JD_rep_c48914_33168544
Contig
2AS_5278308
Probe
wsnp_JD_rep_c48914_33168544
DNA Homology
2AS_5278308Best IWGSC match3680URGI_BestIWGSC_N
BLAST, e-value
02AS_5278308Best IWGSC match
DNA
aaacacactggagaacatagcaggaattgcgtcgtccgatccgttttagc
agctacagctaggtaggatgcttaactggaaatcgatcaaataagagttg
Matcttaaactaatatgcaatgcacaattctcctcctgtcttgggagcac
ggttgggtgctcatttggccatcatgaccttgacaaactcctcatagttg
a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.