Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_JD_rep_c63013_40187485

[ Printable Version ]  [ Submit comment/correction ]

Sequence
wsnp_JD_rep_c63013_40187485
Contig
5BL_10911073
Probe
wsnp_JD_rep_c63013_40187485
DNA Homology
5BL_10911073Best IWGSC match3640URGI_BestIWGSC_N
BLAST, e-value
05BL_10911073Best IWGSC match
DNA
caaggcgatagtggagcgtgccgcccagctcgacgtcgtggtcaccaaca
agctcgccaggctccgcagccaggaggacgagtgaaatgtttcgaacagt
Rgcgcttttggatcgttttgctccctgtagtagacttaatgccgartctg
gagttttcttctctgttcgcctcgaggatccgacgctgttgaacatcttg
c
BLAST
BLAST Search