Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_JD_rep_c63810_40704815

[ Printable Version ]  [ Submit comment/correction ]

Sequence
wsnp_JD_rep_c63810_40704815
Contig
3B_10653792
Probe
wsnp_JD_rep_c63810_40704815
DNA Homology
3B_10653792Best IWGSC match3680URGI_BestIWGSC_N
BLAST, e-value
03B_10653792Best IWGSC match
DNA
aaatgcttttgcttgagatcctgaccgagttcttgcgcaacttgagtttt
gagggacaactgggtgtcattttgtagtgggtgccaagaatcctggtact
Rgagaagtggtaggacctctccttcatgttttgtgcaccgatgtttactg
aagtggtaggacctcaccttcatgtatgacgcactgatttttaccaaata
g
BLAST
BLAST Search