Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_Ku_c10292_17066821

[Submit comment/correction]

Sequence
wsnp_Ku_c10292_17066821
Contig
1AL_3907708
Species
Triticum aestivum
Probe
wsnp_Ku_c10292_17066821
DNA Homology
1AL_3907708Best IWGSC match3680URGI_BestIWGSC_N
BLAST, e-value
01AL_3907708Best IWGSC match
DNA
GGGGTGGACCCTGAGAAGGCCATCAAGTTCGTGGAGGACAGGCCGTTCAA
TGACCAAAGGTACTTTGTGGACGGTGAGAAGATGAGGAGGCTGGGGTGGT
YGGAGCGCACAACGTGGGAGGAGGGACTGAGGAAGACGGTGGAGTGGTAC
GCCAGCAATGCTGATTACTGGGGAGATGTTGGCGTTGTCTTGCGAGGGCA
G

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.