Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_Ku_c12211_19780409

[Submit comment/correction]

Sequence
wsnp_Ku_c12211_19780409
Contig
5AL_2749793
Probe
wsnp_Ku_c12211_19780409
DNA Homology
5AL_2749793Best IWGSC match3530URGI_BestIWGSC_N
BLAST, e-value
05AL_2749793Best IWGSC match
DNA
aagaaatagcatcattttgcgcagatctggtttgatgcatccgttcagca
gctggttgccggtaaatgtgcacattttgtgatgtgtgtttggctgcttg
Ragaaggcgtcgtctatgtagaaggtcgtttcgtttgagtctagtttcgt
ttcgtactgawtttttgctggtttaaaacctcagaggtgaggatggaact
t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.