Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_Ku_c13952_22097895

[Submit comment/correction]

Sequence
wsnp_Ku_c13952_22097895
Contig
1DL_1516067
Probe
wsnp_Ku_c13952_22097895
DNA Homology
1DL_1516067Best IWGSC match2740URGI_BestIWGSC_N
BLAST, e-value
01DL_1516067Best IWGSC match
DNA
tgttcatccttctcagatcgaagcatttcaatgtcactaacattcacgtc
gcacatgaagaggcgcgacgggtagattgaatctacatttgctgacaaat
Rgccaccatatcttgatctggtccatcgataatggttacrtggagtccaa
aggtcattaatacctaactttaccacatcatctgcgctttgatccgcttg
a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.