Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_Ku_c16022_24798741

[ Printable Version ]  [ Submit comment/correction ]

Sequence
wsnp_Ku_c16022_24798741
Contig
7AL_4556192
Probe
wsnp_Ku_c16022_24798741
DNA Homology
7AL_4556192Best IWGSC match3610URGI_BestIWGSC_N
BLAST, e-value
07AL_4556192Best IWGSC match
DNA
gctgtttatacctagggtcgggtcggatcggatgttggttcaattgcaca
tgtttggctgggatgaatcgtgcttataaacattctttataccttgtatt
Rtacaagttatcgtcagtcggtcggtcactttcagtggatattggaaaat
ttccgagcttttttctgtcccatgtttttgtagcattgcttttgtttcct
t
BLAST
BLAST Search