Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_Ku_c16572_25480808

[Submit comment/correction]

Sequence
wsnp_Ku_c16572_25480808
Contig
6BS_672118
Probe
wsnp_Ku_c16572_25480808
DNA Homology
6BS_672118Best IWGSC match3270URGI_BestIWGSC_N
BLAST, e-value
06BS_672118Best IWGSC match
DNA
gacacagctcaatatcacccatcgtgggcttcagatattcattgtatgtc
gaaatagtcccatgactaatgtagtaataactggcaatccttccaaggtc
Mgtaacctgaaagtatcctgttttcctgtcgtactttatcaaattattcc
tatccagcaaatttgcagcagagtgcaccaagtcagctctcctctcatct
a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.