Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_Ku_c16938_25916260

[ Printable Version ]  [ Submit comment/correction ]

Sequence
wsnp_Ku_c16938_25916260
Contig
1BS_3427200
Probe
wsnp_Ku_c16938_25916260
DNA Homology
1BS_3427200Best IWGSC match3590URGI_BestIWGSC_N
BLAST, e-value
01BS_3427200Best IWGSC match
DNA
gctcacagcagaagcctcctctggtagcacggagcttcttcaggaatcca
tggctgaagaaggggtgggaaatgcagagggkatagtgacttatatatgg
Rgaaatggttgctgagagcagaattgagcaagaagagcaacagtgtgtat
ggttgcagataggagatttcagtggaaagcagggaaaggttagggggcga
c
BLAST
BLAST Search