Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_Ku_c21021_30712963

[Submit comment/correction]

Sequence
wsnp_Ku_c21021_30712963
Contig
6AL_5765967
Probe
wsnp_Ku_c21021_30712963
DNA Homology
6AL_5765967Best IWGSC match3680URGI_BestIWGSC_N
BLAST, e-value
06AL_5765967Best IWGSC match
DNA
tcagccttctttggtgaagctctctcacacccaggagccccagagggtct
ggatgcataagctcaggcttctgcccggtgccgggctggtgttcaacccc
Maaaaaagtgaccccgatcggggccaccagacagccgcatcttgttctcc
attaggccttcaggtcatcagacatggccgacgggatgcagtgcgttgtc
a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.