Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_Ku_c39862_48205590

[ Printable Version ]  [ Submit comment/correction ]

Sequence
wsnp_Ku_c39862_48205590
Contig
1BL_3804689
Probe
wsnp_Ku_c39862_48205590
DNA Homology
1BL_3804689Best IWGSC match3680URGI_BestIWGSC_N
BLAST, e-value
01BL_3804689Best IWGSC match
DNA
attatataccatgttctgaacagaggagcggagttattgtaaaaactatc
taatgtttagttgcttgtataaaacacaagttttgaagaaaataggatat
Mtgtgttgtgaatatacatggcctgcaaattccagtgctaacagcataat
atttcaaatgtggatgtaaggccgatcagatttcaccaaagtagccatgg
g
BLAST
BLAST Search