Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_Ku_c47082_53641298

[ Printable Version ]  [ Submit comment/correction ]

Sequence
wsnp_Ku_c47082_53641298
Contig
2BL_8035556
Probe
wsnp_Ku_c47082_53641298
DNA Homology
2BL_8035556Best IWGSC match2480URGI_BestIWGSC_N
BLAST, e-value
02BL_8035556Best IWGSC match
DNA
atcttaatacttcccaactcccatagttgaacagacgagaatcccacatc
caatgatggccacgtggaccaccgtggaagtaatgtgtatcagtgccatc
Raaaccattcaaaccgtcaagggtattatttgacgaatgactatgaacaa
tatccataagaacaagcaaaccaagctcatgtgctctatcgatcaaggat
t
BLAST
BLAST Search