Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_Ku_c4910_8793327

[Submit comment/correction]

Sequence
wsnp_Ku_c4910_8793327
Contig
6BL_4312504
Probe
wsnp_Ku_c4910_8793327
DNA Homology
6BL_4312504Best IWGSC match3680URGI_BestIWGSC_N
BLAST, e-value
06BL_4312504Best IWGSC match
DNA
aggatggtctatcccaaagtatctgaagaaataaactggggtcaaggacc
actcccaggagtacttgaatatccagcaaccattgatgtttccgatcaac
Raaacgtgattgttagccaacaaagccaagacatcattacaattgatcat
agtacccaccttgcaaagcataaagaatggtactcatctgggagtacaga
g
BLAST
BLAST Search

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.